bio vision fluorescence image acquisition system (VILBER GmbH)
VILBER GmbH is a verified supplier 
VILBER GmbH manufactures this product 
98
Structured Review
VILBER GmbH
bio vision fluorescence image acquisition system
Bio Vision Fluorescence Image Acquisition System, supplied by VILBER GmbH, used in various techniques. Bioz Stars score: 98/100, based on 1815 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bio+vision+fluorescence+image+acquisition+system/DOC+PRINT/10__1074_slash_jbc__m708188200-104-13-18
Average 98 stars, based on 1815 article reviews
Bio Vision Fluorescence Image Acquisition System, supplied by VILBER GmbH, used in various techniques. Bioz Stars score: 98/100, based on 1815 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bio+vision+fluorescence+image+acquisition+system/DOC+PRINT/10__1074_slash_jbc__m708188200-104-13-18
Average 98 stars, based on 1815 article reviews
bio vision fluorescence image acquisition system - by Bioz Stars,
2026-10
98/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors Article Snippet: For detection of E1A splice variants, 2 l of the RT reaction was used as template, and PCR amplification (Takara ExTaq, 50 l, 35 cycles) was performed using primers CAAGCTTGAGTGCCAGCGAGTAG (P1) and CTCAGGTTCAGACACAGG (P3). .. PCR products were visualized via 1% agarose gels stained with ethidium bromide using Staining:Article Title: Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors Article Snippet: For detection of E1A splice variants, 2 l of the RT reaction was used as template, and PCR amplification (Takara ExTaq, 50 l, 35 cycles) was performed using primers CAAGCTTGAGTGCCAGCGAGTAG (P1) and CTCAGGTTCAGACACAGG (P3). .. PCR products were visualized via 1% agarose gels stained with ethidium bromide using Fluorescence:Article Title: Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors Article Snippet: For detection of E1A splice variants, 2 l of the RT reaction was used as template, and PCR amplification (Takara ExTaq, 50 l, 35 cycles) was performed using primers CAAGCTTGAGTGCCAGCGAGTAG (P1) and CTCAGGTTCAGACACAGG (P3). .. PCR products were visualized via 1% agarose gels stained with ethidium bromide using Software:Article Title: Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors Article Snippet: For detection of E1A splice variants, 2 l of the RT reaction was used as template, and PCR amplification (Takara ExTaq, 50 l, 35 cycles) was performed using primers CAAGCTTGAGTGCCAGCGAGTAG (P1) and CTCAGGTTCAGACACAGG (P3). .. PCR products were visualized via 1% agarose gels stained with ethidium bromide using |